Entry Detail



General Information

Database ID:TRD06917
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.06 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-011893
tsRNA Type:tRF-1
Amino acid and Anticodon:N/A
Sequence:GTTTATGTGGGAAGTGATATATT
Related Target:N/A
Predicted Target:AR//HIPK2//TAOK2//ROPN1//ENAM//F2//PXMP4//PCNT//SCUBE1//G2E3
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D051436DOID:784
Disease Name:Renal Insufficiency, Chronicchronic kidney disease
Category:MeSHDisease Ontology
Type:Urogenital Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:Conditions in which the KIDNEYS perform below the normal level for more than three months. Chronic kidney insufficiency is classified by five stages according to the decline in GLOMERULAR FILTRATION RATE and the degree of kidney damage (as measured by the level of PROTEINURIA). The most severe form is the end-stage renal disease (CHRONIC KIDNEY FAILURE). (Kidney Foundation: Kidney Disease Outcome Quality Initiative, 2002)A kidney failure that is characterized by the gradual loss of kidney function.
Alias:Chronic Kidney Diseases//Chronic Kidney Insufficiency//Chronic Renal Diseases//Chronic Renal Insufficiency//Kidney Insufficiency, ChronicN/A



Disease Association Statistics

Total Associated tsRNA Number:197
More Information
Network:
(Display the first 15 nodes)