Entry Detail



General Information

Database ID:TRD06810
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-008916
tsRNA Type:tRF-1
Amino acid and Anticodon:ThrCGT
Sequence:GCGTTTGGAAGAGATATTTT
Related Target:N/A
Predicted Target:ZNF611//ZNF468//ZNF28//ZNF813//ZNF761//ZNF578//ZNF320//ZNF808//TRIP13//EI24
External Links:
MINTbase ID:N/A
tRFdb ID:tRFdb-1007



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009402N/A
Disease Name:Nephrosis, LipoidN/A
Category:MeSHDisease Ontology
Type:Urogenital DiseasesN/A
Define:A kidney disease with no or minimal histological glomerular changes on light microscopy and with no immune deposits. It is characterized by lipid accumulation in the epithelial cells of KIDNEY TUBULES and in the URINE. Patients usually show NEPHROTIC SYNDROME indicating the presence of PROTEINURIA with accompanying EDEMA.N/A
Alias:Glomerulonephritis, Minimal Change//Glomerulopathy, Minimal Change//Idiopathic Minimal Change Nephrotic Syndrome//Minimal Change Disease//Minimal Change Glomerulopathy//Minimal Change Nephrotic Syndrome//Nephropathy, Minimal Change//Nephrotic Syndrome, Minimal ChangeN/A



Disease Association Statistics

Total Associated tsRNA Number:32
More Information
Network:
(Display the first 15 nodes)