Entry Detail



General Information

Database ID:TRD06805
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:ts-53
tsRNA Type:tRF-1
Amino acid and Anticodon:ThrAGT
Sequence:GCCTCCGTGTTTCCCCCACGCTTTTGCCA
Related Target:N/A
Predicted Target:SAMD12//HIPK2//NHLH2//C16orf71//SPOPL//FBXW4//FAM98C//CYP26B1//ZNF771//CAMK1D
External Links:
MINTbase ID:N/A
tRFdb ID:ts-53



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009190DOID:0050908
Disease Name:Myelodysplastic Syndromesmyelodysplastic syndrome
Category:MeSHDisease Ontology
Type:Hemic and Lymphatic Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Clonal hematopoietic stem cell disorders characterized by dysplasia in one or more hematopoietic cell lineages. They predominantly affect patients over 60, are considered preleukemic conditions, and have high probability of transformation into ACUTE MYELOID LEUKEMIA.A bone marrow cancer that is characterized by under production of white blood cells, red blood cells and platelets.
Alias:Dysmyelopoietic Syndromes//Hematopoetic MyelodysplasiaN/A



Disease Association Statistics

Total Associated tsRNA Number:83
More Information
Network:
(Display the first 15 nodes)