Entry Detail



General Information

Database ID:TRD06686
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:ts-46
tsRNA Type:tRF-1
Amino acid and Anticodon:HisGTG
Sequence:TTGTGGAAACAATGGTACGGCAAGGGCCTCTTT
Related Target:N/A
Predicted Target:ENAM//PREX1//ARV1//C17orf53//GAS2L1//VPS18//MVP//MDN1//TF//PORCN
External Links:
MINTbase ID:N/A
tRFdb ID:ts-46



tsRNA Association Statistics

Total Associated Disease Number:9
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D011565DOID:8893
Disease Name:Psoriasispsoriasis
Category:MeSHDisease Ontology
Type:Skin and Connective Tissue Diseasesdisease of anatomical entity
Define:A common genetically determined, chronic, inflammatory skin disease characterized by rounded erythematous, dry, scaling patches. The lesions have a predilection for nails, scalp, genitalia, extensor surfaces, and the lumbosacral region. Accelerated epidermopoiesis is considered to be the fundamental pathologic feature in psoriasis.A skin disease that is characterized by patches of thick red skin and silvery scales.
Alias:Palmoplantaris Pustulosis//Pustular Psoriasis of Palms and Soles//Pustulosis Palmaris et Plantaris//Pustulosis of Palms and SolesN/A



Disease Association Statistics

Total Associated tsRNA Number:71
More Information
Network:
(Display the first 15 nodes)