Entry Detail


General Information

Database ID:TRD06584
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:Gly-tRF
tsRNA Type:i-tRF
Amino acid and Anticodon:N/A
Sequence:GCGAGAATTCTACCACTGAACCACCAATGC
Related Target:NDFIP2
Predicted Target:PBX2//KRT1//BNIP1//ATP6AP2//CLCN6//SNX22//MYBPC3//DEXI//GPAT4//LAX1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077192DOID:3910
Disease Name:Adenocarcinoma of Lunglung adenocarcinoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of anatomical entity//disease of cellular proliferation
Define:A carcinoma originating in the lung and the most common lung cancer type in never-smokers. Malignant cells exhibit distinct features such as glandular epithelial, or tubular morphology. Mutations in KRAS, EGFR, BRAF, and ERBB2 genes are associated with this cancer.A lung non-small cell carcinoma that derives_from epithelial cells of glandular origin.
Alias:Lung Adenocarcinomaadenocarcinoma of lung//bronchogenic lung adenocarcinoma//nonsmall cell adenocarcinoma



Disease Association Statistics

Total Associated tsRNA Number:203
More Information
Network:
(Display the first 15 nodes)