Entry Detail


General Information

Database ID:TRD06544
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-36-F900BY4D84KRIME
tsRNA Type:i-tRF
Amino acid and Anticodon:SerGCT
Sequence:AGCTCACAAGAACTGCTAACTCATGCCCCCATGTCT
Related Target:N/A
Predicted Target:CDS2//FBN3//ZBTB7A//SPI1//ZDHHC22//HADHB//LIMD1//ACVR1//AHDC1//TRIM74
External Links:
MINTbase ID:tRF-36-F900BY4D84KRIME
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12212        End Site(bp): 12247



tsRNA Association Statistics

Total Associated Disease Number:8
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D017202N/A
Disease Name:Myocardial IschemiaN/A
Category:MeSHDisease Ontology
Type:Cardiovascular DiseasesN/A
Define:A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION).N/A
Alias:Heart Disease, Ischemic//Ischemia, Myocardial//Ischemic Heart DiseaseN/A



Disease Association Statistics

Total Associated tsRNA Number:59
More Information
Network:
(Display the first 15 nodes)