Entry Detail



General Information

Database ID:TRD06416
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-22-JNORRNLNJ
tsRNA Type:i-tRF
Amino acid and Anticodon:GlyTCC
Sequence:CAGTTGACCCGGGTTCGATCC
Related Target:N/A
Predicted Target:NLRX1//ZNF699//TRERF1//MAPK12//RNGTT//MTERF4//DLG3//ZIC1//SON//PARP10
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D017565DOID:13406
Disease Name:Sarcoidosis, Pulmonarypulmonary sarcoidosis
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Hemic and Lymphatic Diseases//Immune System Diseasesdisease of anatomical entity
Define:Sarcoidosis affecting predominantly the lungs, the site most frequently involved and most commonly causing morbidity and mortality in sarcoidosis. Pulmonary sarcoidosis is characterized by sharply circumscribed granulomas in the alveolar, bronchial, and vascular walls, composed of tightly packed cells derived from the mononuclear phagocyte system. The clinical symptoms when present are dyspnea upon exertion, nonproductive cough, and wheezing. (Cecil Textbook of Medicine, 19th ed, p431)A sarcoidosis that is characterized by noncaseating granulomatous infiltration of the lungs and supporting lymph nodes, bilateral hilar adenopathy, and pulmonary issues, has_symptom shortness of breath, fatigue, wheezing, and chronic cough, and develops_from a type IV hypersensitivity reaction.
Alias:Pulmonary Sarcoidosislung Sarcoidosis



Disease Association Statistics

Total Associated tsRNA Number:33
More Information
Network:
(Display the first 15 nodes)