Entry Detail



General Information

Database ID:TRD06414
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-22-JNORRNLNJ
tsRNA Type:i-tRF
Amino acid and Anticodon:GlyTCC
Sequence:CAGTTGACCCGGGTTCGATCC
Related Target:N/A
Predicted Target:NLRX1//ZNF699//TRERF1//MAPK12//RNGTT//MTERF4//DLG3//ZIC1//SON//PARP10
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000086382DOID:0080600
Disease Name:COVID-19COVID-19
Category:MeSHDisease Ontology
Type:Infections//Respiratory Tract Diseasesdisease by infectious agent
Define:A viral disorder generally characterized by high FEVER; COUGH; DYSPNEA; CHILLS; PERSISTENT TREMOR; MUSCLE PAIN; HEADACHE; SORE THROAT; a new loss of taste and/or smell (see AGEUSIA and ANOSMIA) and other symptoms of a VIRAL PNEUMONIA. In severe cases, a myriad of coagulopathy associated symptoms often correlating with COVID-19 severity is seen (e.g., BLOOD COAGULATION; THROMBOSIS; ACUTE RESPIRATORY DISTRESS SYNDROME; SEIZURES; HEART ATTACK; STROKE; multiple CEREBRAL INFARCTIONS; KIDNEY FAILURE; catastrophic ANTIPHOSPHOLIPID ANTIBODY SYNDROME and/or DISSEMINATED INTRAVASCULAR COAGULATION). In younger patients, rare inflammatory syndromes are sometimes associated with COVID-19 (e.g., atypical KAWASAKI SYNDROME; TOXIC SHOCK SYNDROME; pediatric multisystem inflammatory disease; and CYTOKINE STORM SYNDROME). A coronavirus, SARS-CoV-2, in the genus BETACORONAVIRUS is the causative agent.A Coronavirus infectious disease that is characterized by fever, cough and shortness of breath and that has_material_basis_in SARS-CoV-2.
Alias:2019 Novel Coronavirus Disease//2019 Novel Coronavirus Infection//2019-nCoV Disease//2019-nCoV Infection//COVID-19 Pandemic//COVID-19 Pandemics//COVID-19 Virus Disease//COVID-19 Virus Infection//COVID19//Coronavirus Disease 2019//Coronavirus Disease-19//SARS Coronavirus 2 Infection//SARS-CoV-2 Infection//Severe Acute Respiratory Syndrome Coronavirus 2 Infection2019 Novel Coronavirus (2019-nCoV)//2019-nCoV infection//COVID19//SARS-CoV-2 infection//Wuhan coronavirus infection//Wuhan seafood market pneumonia virus infection



Disease Association Statistics

Total Associated tsRNA Number:67
More Information
Network:
(Display the first 15 nodes)