Entry Detail



General Information

Database ID:TRD06397
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Gly-GCC-002_n1
tsRNA Type:i-tRF
Amino acid and Anticodon:GlyGCC
Sequence:ATCGCATTGGTGGTTCAGTG
Related Target:N/A
Predicted Target:FCGR2A//ERAS//ZNF526//ADAR//RWDD1//PRDM15//RC3H2//COMMD3//TBC1D2B//PTGER4
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010300DOID:14330
Disease Name:Parkinson DiseaseParkinson's disease
Category:MeSHDisease Ontology
Type:Nervous System Diseasesdisease of anatomical entity
Define:A progressive, degenerative neurologic disease characterized by a TREMOR that is maximal at rest, retropulsion (i.e. a tendency to fall backwards), rigidity, stooped posture, slowness of voluntary movements, and a masklike facial expression. Pathologic features include loss of melanin containing neurons in the substantia nigra and other pigmented nuclei of the brainstem. LEWY BODIES are present in the substantia nigra and locus coeruleus but may also be found in a related condition (LEWY BODY DISEASE, DIFFUSE) characterized by dementia in combination with varying degrees of parkinsonism. (Adams et al., Principles of Neurology, 6th ed, p1059, pp1067-75)A synucleinopathy that has_material_basis_in degeneration of the central nervous system that often impairs motor skills, speech, and other functions.
Alias:Idiopathic Parkinson Disease//Idiopathic Parkinson's Disease//Lewy Body Parkinson Disease//Lewy Body Parkinson's Disease//Paralysis Agitans//Parkinson Disease, Idiopathic//Parkinson's Disease//Parkinson's Disease, Idiopathic//Parkinson's Disease, Lewy Body//Primary Parkinsonismparalysis agitans//Parkinson disease



Disease Association Statistics

Total Associated tsRNA Number:84
More Information
Network:
(Display the first 15 nodes)