tsRNADisease

Entry Detail

General Information

Database ID:	TRD06373
Confidence:	Prediction
Confidence Score:	0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tRF-25-9M739P8WQ0

tsRNA Type:

i-tRF

Amino acid and Anticodon:

GluTTC

Sequence:

TGGTCGTGGTTGTAGTCCGTGCGAG

Related Target:

N/A

Predicted Target:

ACAD9//CACNG8//CPAMD8//SLC30A1//SEPTIN4//RSPO2//FAM181B//TSNAXIP1//RREB1//PACS2

External Links:

MINTbase ID:	tRF-25-9M739P8WQ0
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	19 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D008113	DOID:3571
Disease Name:	Liver Neoplasms	liver cancer
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Digestive System Diseases	disease of anatomical entity//disease of cellular proliferation
Define:	Tumors or cancer of the LIVER.	A hepatobiliary system cancer that is located_in the liver.
Alias:	Cancer of Liver//Cancer of the Liver//Cancer, Hepatocellular//Hepatic Cancer//Hepatic Neoplasms//Hepatocellular Cancer//Liver Cancer//Neoplasms, Hepatic//Neoplasms, Liver	Ca liver - primary//hepatic cancer//hepatic neoplasm//malignant hepato-biliary neoplasm//malignant neoplasm of liver//malignant neoplasm of liver, not specified as primary or secondary malignant neoplasm of liver, primary [EXACT] malignant tumor of liver [EXACT] neoplasm of liver [EXACT] non-resectable primary hepatic malignant neoplasm [EXACT] primary liver cancer [EXACT] primary malignant neoplasm of liver [EXACT] Resectable malignant neoplasm of Liver [EXACT] resectable malignant neoplasm of the liver [EXACT]

Disease Association Statistics

Total Associated tsRNA Number:	39 More Information
Network: (Display the first 15 nodes)