tsRNADisease

Entry Detail

General Information

Database ID:	TRD06353
Confidence:	Prediction
Confidence Score:	0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tRF-21-I8W47W1R0

tsRNA Type:

i-tRF

Amino acid and Anticodon:

GluTTC

Sequence:

ATTGGTCGTGGTTGTAGTCCG

Related Target:

N/A

Predicted Target:

KLK1//CACNG8//ACE2//AC097625.2//GALK1//PLXNB3//MMP2//MUC5B//ACAD9//ERGIC2

External Links:

MINTbase ID:	tRF-21-I8W47W1R0
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	24 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D011085	DOID:11612
Disease Name:	Polycystic Ovary Syndrome	polycystic ovary syndrome
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Urogenital Diseases//Endocrine System Diseases	disease of anatomical entity//reproductive system disease
Define:	A complex disorder characterized by infertility, HIRSUTISM; OBESITY; and various menstrual disturbances such as OLIGOMENORRHEA; AMENORRHEA; ANOVULATION. Polycystic ovary syndrome is usually associated with bilateral enlarged ovaries studded with atretic follicles, not with cysts. The term, polycystic ovary, is misleading.	An ovarian dysfunction that is characterized by hyperandrogenism, polycystic ovaries, hirsutism, oligomenorrhea or amenorrhea, anovulation and excessive body weight.
Alias:	Polycystic Ovarian Syndrome//Polycystic Ovary Syndrome 1//Sclerocystic Ovarian Degeneration//Sclerocystic Ovaries//Sclerocystic Ovary Syndrome//Stein-Leventhal Syndrome	Multicystic ovaries//PCOS//Polycystic Ovarian disease//Polycystic ovaries//polycystic ovary//Stein-Leventhal synd//Stein-Leventhal syndrome

Disease Association Statistics

Total Associated tsRNA Number:	74 More Information
Network: (Display the first 15 nodes)