Entry Detail



General Information

Database ID:TRD06285
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-21-NB8PLML3E
tsRNA Type:i-tRF
Amino acid and Anticodon:GlnCTG
Sequence:CGTAATCCAGCGATCCGAGTT
Related Target:N/A
Predicted Target:RTF1//DNAH7//TENT5B//NEURL1//MARVELD2//PPP1R9A//C1orf159//PCDHB14//NPHP4//NUDT21
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000073605DOID:11103
Disease Name:Spotted Fever Group Rickettsiosisrickettsialpox
Category:MeSHDisease Ontology
Type:Infectionsdisease by infectious agent
Define:A group of arthropod-borne diseases caused by spotted fever bio-group members of RICKETTSIA. They are characterized by fever, headache, and petechial (spotted) rash.A spotted fever that has_material_basis_in Rickettsia akari, which is transmitted_by house mouse mite (Liponyssoides sanguineus) found on mice and other rodents. The infection has_symptom fever, has_symptom chills, has_symptom headache, has_symptom myalgia, and has_symptom papulovesicular rash.
Alias:African Tick-Bite Fever//Far Eastern Spotted Fever//Flinders Island Spotted Fever//Japanese Spotted Fever//North Asian Tick Typhus//Queensland Tick Typhus/Rickettsia aeschlimannii Infection//Rickettsia africae Infection//Rickettsia akari Infection Rickettsia australis Infection//Rickettsia slovaca Infection//Rickettsialpox//Spotted Fever Group Rickettsioses//Spotted Fevers//TIBOLA//Tick-Borne LymphadenopathyRickettsia akari spotted fever //Vesicular rickettsiosis



Disease Association Statistics

Total Associated tsRNA Number:91
More Information
Network:
(Display the first 15 nodes)