Entry Detail


General Information

Database ID:TRD06284
Confidence:Prediction
Confidence Score:0.04 (L1-norm-Graph) & 0.09 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-21-NB8PLML3E
tsRNA Type:i-tRF
Amino acid and Anticodon:GlnCTG
Sequence:CGTAATCCAGCGATCCGAGTT
Related Target:N/A
Predicted Target:RTF1//DNAH7//TENT5B//NEURL1//MARVELD2//PPP1R9A//C1orf159//PCDHB14//NPHP4//NUDT21
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009203DOID:5844
Disease Name:Myocardial Infarctionmyocardial infarction
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:NECROSIS of the MYOCARDIUM caused by an obstruction of the blood supply to the heart (CORONARY CIRCULATION).A coronary artery disease characterized by myocardial cell death (myocardial necrosis) due to prolonged ischaemia.
Alias:Cardiovascular Stroke//Heart Attack//Myocardial Infarctheart attack//Myocardial infarct



Disease Association Statistics

Total Associated tsRNA Number:358
More Information
Network:
(Display the first 15 nodes)