Entry Detail


General Information

Database ID:TRD06207
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.05 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-M0NK5Y93
tsRNA Type:i-tRF
Amino acid and Anticodon:ArgCCG
Sequence:CGGAGCTGGGGATTGTGGGT
Related Target:MALAT1
Predicted Target:CDCP2//AL357673.1//MUC5B//TMEM150C//MUC12//C1orf159//SLC39A13//MAOA//MROH1//RILP
External Links:
MINTbase ID:tRF-20-M0NK5Y93
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-CCG-2-1
Anticodon:ArgCCG
tRNA_number:trna23
Chromosome:17
Strand:-
Coordinate:Start Site(bp): 66016032        End Site(bp): 66016051



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D043183DOID:9778
Disease Name:Irritable Bowel Syndromeirritable bowel syndrome
Category:MeSHDisease Ontology
Type:Digestive System Diseasesdisease of anatomical entity
Define:A disorder with chronic or recurrent colonic symptoms without a clearcut etiology. This condition is characterized by chronic or recurrent ABDOMINAL PAIN, bloating, MUCUS in FECES, and an erratic disturbance of DEFECATION.An intestinal disease that is characterized by chronic abdominal pain, discomfort, bloating, and alteration of bowel habits in the absence of any detectable organic cause.
Alias:Colitis, Mucous//Colon, IrritableIBD//Irritable colon//Psychogenic IBS



Disease Association Statistics

Total Associated tsRNA Number:44
More Information
Network:
(Display the first 15 nodes)