Entry Detail


General Information

Database ID:TRD06204
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-M0NK5Y93
tsRNA Type:i-tRF
Amino acid and Anticodon:ArgCCG
Sequence:CGGAGCTGGGGATTGTGGGT
Related Target:MALAT1
Predicted Target:CDCP2//AL357673.1//MUC5B//TMEM150C//MUC12//C1orf159//SLC39A13//MAOA//MROH1//RILP
External Links:
MINTbase ID:tRF-20-M0NK5Y93
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-CCG-2-1
Anticodon:ArgCCG
tRNA_number:trna23
Chromosome:17
Strand:-
Coordinate:Start Site(bp): 66016032        End Site(bp): 66016051



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077277DOID:3748
Disease Name:Esophageal Squamous Cell Carcinomaesophagus squamous cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A carcinoma that originates usually from cells on the surface of the middle and lower third of the ESOPHAGUS. Tumor cells exhibit typical squamous morphology and form large polypoid lesions. Mutations in RNF6, LZTS1, TGFBR2, DEC1, and WWOX1 genes are associated with this cancer.An esophageal carcinoma that derives_from epithelial squamous cells located_in the esophagus.
Alias:Oesophageal Squamous Cell Carcinomaoesophagus squamous cell carcinoma//SCC of esophagus//SCC of oesophagus



Disease Association Statistics

Total Associated tsRNA Number:32
More Information
Network:
(Display the first 15 nodes)