Entry Detail



General Information

Database ID:TRD06189
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-001363
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:N/A
Sequence:GCCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCT
Related Target:N/A
Predicted Target:EBI3//COMMD2//NHLRC1//FLYWCH1//NAAA//MKNK1//RPS6KA2//ATXN2//SPIRE2//USP24
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003586DOID:0080827
Disease Name:Cytomegalovirus Infectionshuman cytomegalovirus infection
Category:MeSHDisease Ontology
Type:Infectionsdisease by infectious agent
Define:Infection with CYTOMEGALOVIRUS, characterized by enlarged cells bearing intranuclear inclusions. Infection may be in almost any organ, but the salivary glands are the most common site in children, as are the lungs in adults.A viral infectious disease that has_material_basis_in Human betaherpesvirus 5.
Alias:CMV Inclusion//CMV Inclusions//Congenital CMV Infection//Congenital Cytomegalovirus Infection//Cytomegalic Inclusion Disease//Cytomegalovirus Colitis//Cytomegalovirus Inclusion//Cytomegalovirus Inclusion Disease//Cytomegalovirus Inclusions//Inclusion Disease//Infections, Cytomegalovirus//Perinatal CMV Infection//Perinatal Cytomegalovirus Infection//Renal Tubular Cytomegalovirus Inclusion//Renal Tubular Cytomegalovirus Inclusions//Salivary Gland Virus Disease//Severe Cytomegalovirus Infection//Severe Cytomegalovirus InfectionsN/A



Disease Association Statistics

Total Associated tsRNA Number:39
More Information
Network:
(Display the first 15 nodes)