Entry Detail



General Information

Database ID:TRD06048
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.01 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Val-CAC-002
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:ValCAC
Sequence:GTTTCCGTAGTGTAGCGGTTATCACATTCGCCTC
Related Target:N/A
Predicted Target:PLEKHG5//CDYL2//KLK10//GPC6//GALNTL6//ILRUN//SOCS2//SNX1//TRERF1//CIAO3
External Links:
MINTbase ID:tRF-34-79MP9PMNH5IS15
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-3-1
Anticodon:ValCAC
tRNA_number:trna13
Chromosome:19
Strand:-
Coordinate:Start Site(bp): 4724686        End Site(bp): 4724719



tsRNA Association Statistics

Total Associated Disease Number:25
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020181DOID:0050848
Disease Name:Sleep Apnea, Obstructiveobstructive sleep apnea
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Nervous System Diseasesdisease of mental health
Define:A disorder characterized by recurrent apneas during sleep despite persistent respiratory efforts. It is due to upper airway obstruction. The respiratory pauses may induce HYPERCAPNIA or HYPOXIA. Cardiac arrhythmias and elevation of systemic and pulmonary arterial pressures may occur. Frequent partial arousals occur throughout sleep, resulting in relative SLEEP DEPRIVATION and daytime tiredness. Associated conditions include OBESITY; ACROMEGALY; MYXEDEMA; micrognathia; MYOTONIC DYSTROPHY; adenotonsilar dystrophy; and NEUROMUSCULAR DISEASES. (From Adams et al., Principles of Neurology, 6th ed, p395)A sleep apnea that is characterized by repeated collapse and obstruction of the upper airway during sleep, which results in reduced airflow (hypopnea) or complete airflow cessation (apnea), oxygen desaturation, and arousals from sleep.
Alias:Apnea, Obstructive Sleep//OSAHS//Obstructive Sleep Apnea//Obstructive Sleep Apnea Syndrome//Sleep Apnea Hypopnea Syndrome//Sleep Apnea Syndrome, Obstructive//Syndrome, Obstructive Sleep Apnea//Syndrome, Sleep Apnea, Obstructive//Syndrome, Upper Airway Resistance, Sleep Apnea//Upper Airway Resistance Sleep Apnea Syndromeobstructive sleep apnea syndrome



Disease Association Statistics

Total Associated tsRNA Number:67
More Information
Network:
(Display the first 15 nodes)