Entry Detail



General Information

Database ID:TRD06020
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Val-CAC-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATCACGTTCGCCTC
Related Target:N/A
Predicted Target:ZBED2//ERAP1//PTPN14//OBSCN//NPTXR//CLASRP//NR1H3//AGRN//HK2//CDC25C
External Links:
MINTbase ID:tRF-34-Q99P9P9NH57S15
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248088        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:43
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077274DOID:9261
Disease Name:Nasopharyngeal Carcinomanasopharynx carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Stomatognathic Diseases//Otorhinolaryngologic Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A carcinoma that originates in the EPITHELIUM of the NASOPHARYNX and includes four subtypes: keratinizing squamous cell, non-keratinizing, basaloid squamous cell, and PAPILLARY ADENOCARCINOMA. It is most prevalent in Southeast Asian populations and is associated with EPSTEIN-BARR VIRUS INFECTIONS. Somatic mutations associated with this cancer have been identified in NPCR, BAP1, UBAP1, ERBB2, ERBB3, MLL2, PIK3CA, KRAS, NRAS, and ARID1A genes.A pharynx cancer that is located in the nasopharynx, the uppermost region of the pharynx or throat, where the nasal passages and auditory tubes join the remainder of the upper respiratory tract.
Alias:N/Acarcinoma of nasopharynx//malignant Nasopharyngeal tumor//malignant neoplasm of nasopharynx//Nasopharyngeal carcinoma//nasopharynx cancer



Disease Association Statistics

Total Associated tsRNA Number:21
More Information
Network:
(Display the first 15 nodes)