Entry Detail



General Information

Database ID:TRD05958
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020521N/A
Disease Name:StrokeN/A
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Cardiovascular DiseasesN/A
Define:A group of pathological conditions characterized by sudden, non-convulsive loss of neurological function due to BRAIN ISCHEMIA or INTRACRANIAL HEMORRHAGES. Stroke is classified by the type of tissue NECROSIS, such as the anatomic location, vasculature involved, etiology, age of the affected individual, and hemorrhagic vs. non-hemorrhagic nature. (From Adams et al., Principles of Neurology, 6th ed, pp777-810)N/A
Alias:Apoplexy//CVA (Cerebrovascular Accident)//Cerebral Stroke//Cerebrovascular Accident//Cerebrovascular Accident, Acute//Cerebrovascular Apoplexy//Cerebrovascular Stroke//Stroke, Acute//Vascular Accident, BrainN/A



Disease Association Statistics

Total Associated tsRNA Number:46
More Information
Network:
(Display the first 15 nodes)