Entry Detail



General Information

Database ID:TRD05955
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D012214DOID:0050827
Disease Name:Rheumatic Heart Diseaserheumatic heart disease
Category:MeSHDisease Ontology
Type:Infections//Cardiovascular Diseasesdisease of anatomical entity
Define:Cardiac manifestation of systemic rheumatological conditions, such as RHEUMATIC FEVER. Rheumatic heart disease can involve any part the heart, most often the HEART VALVES and the ENDOCARDIUM.A heart valve disease that is characterized by repeated inflammation with fibrinous repair caused by an autoimmune reaction to Group A beta-hemolytic streptococci (GAS) that results in valvular damage. The cardinal anatomic changes of the valve include leaflet thickening, commissural fusion, and shortening and thickening of the tendinous cords.
Alias:Bouillaud Disease//Bouillaud's Diseaserheumatic carditis



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)