Entry Detail



General Information

Database ID:TRD05953
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009765DOID:9970
Disease Name:Obesityobesity
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Pathological Conditions, Signs and Symptomsdisease of metabolism
Define:A status with BODY WEIGHT that is grossly above the recommended standards, usually due to accumulation of excess FATS in the body. The standards may vary with age, sex, genetic or cultural background. In the BODY MASS INDEX, a BMI greater than 30.0 kg/m2 is considered obese, and a BMI greater than 40.0 kg/m2 is considered morbidly obese (MORBID OBESITY).An overnutrition that is characterized by excess body fat, traditionally defined as an elevated ratio of weight to height (specifically 30 kilograms per meter squared), has_material_basis_in a multifactorial etiology related to excess nutrition intake, decreased caloric utilization, and genetic susceptibility, and possibly medications and certain disorders of metabolism, endocrine function, and mental illness.
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:55
More Information
Network:
(Display the first 15 nodes)