Entry Detail



General Information

Database ID:TRD05951
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009205DOID:820
Disease Name:Myocarditismyocarditis
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:Inflammatory processes of the muscular walls of the heart (MYOCARDIUM) which result in injury to the cardiac muscle cells (MYOCYTES, CARDIAC). Manifestations range from subclinical to sudden death (DEATH, SUDDEN). Myocarditis in association with cardiac dysfunction is classified as inflammatory CARDIOMYOPATHY usually caused by INFECTION, autoimmune diseases, or responses to toxic substances. Myocarditis is also a common cause of DILATED CARDIOMYOPATHY and other cardiomyopathies.An extrinsic cardiomyopathy that is characterized as an inflammation of the heart muscle.
Alias:CarditisMyocardial inflammation



Disease Association Statistics

Total Associated tsRNA Number:58
More Information
Network:
(Display the first 15 nodes)