Entry Detail



General Information

Database ID:TRD05944
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006330DOID:1682
Disease Name:Heart Defects, Congenitalcongenital heart disease
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Congenital, Hereditary, and Neonatal Diseases and Abnormalitiesphysical disorder//disease of anatomical entity
Define:Developmental abnormalities involving structures of the heart. These defects are present at birth but may be discovered later in life.N/A
Alias:Abnormality, Heart//Congenital Heart Defect//Congenital Heart Defects//Congenital Heart Disease//Defects, Congenital Heart//Heart Abnormalities//Heart Defect, Congenital//Heart, Malformation OfCongenital anomaly of heart//congenital heart defect//Congenital Heart Defects//heart defect//Heart Malformation//Heart-congenital defect



Disease Association Statistics

Total Associated tsRNA Number:62
More Information
Network:
(Display the first 15 nodes)