Entry Detail



General Information

Database ID:TRD05942
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D004827DOID:1826
Disease Name:Epilepsyepilepsy
Category:MeSHDisease Ontology
Type:Nervous System Diseasesdisease of anatomical entity
Define:A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313)A brain disease that is characterized by the occurrance of at least two unprovoked seizures resulting from a persistent epileptogenic abnormality of the brain that is able to spontaneously generate paroxysmal activity and typically manifested by sudden brief episodes of altered or diminished consciousness, involuntary movements, or convulsions.
Alias:Aura//Awakening Epilepsy//Epilepsy, Cryptogenic//Seizure Disorderepilepsy syndrome//epileptic syndrome



Disease Association Statistics

Total Associated tsRNA Number:47
More Information
Network:
(Display the first 15 nodes)