Entry Detail



General Information

Database ID:TRD05939
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002312DOID:11984
Disease Name:Cardiomyopathy, Hypertrophichypertrophic cardiomyopathy
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:A form of CARDIAC MUSCLE disease, characterized by left and/or right ventricular hypertrophy (HYPERTROPHY, LEFT VENTRICULAR; HYPERTROPHY, RIGHT VENTRICULAR), frequent asymmetrical involvement of the HEART SEPTUM, and normal or reduced left ventricular volume. Risk factors include HYPERTENSION; AORTIC STENOSIS; and gene MUTATION; (FAMILIAL HYPERTROPHIC CARDIOMYOPATHY).An intrinsic cardiomyopathy that is characterized by abnormal thickening (hypertrophy) of the heart without any obvious cause.
Alias:Cardiomyopathy, Hypertrophic Obstructivehypertrophic obstructive cardiomyopathy



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)