Entry Detail



General Information

Database ID:TRD05938
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002311DOID:12930
Disease Name:Cardiomyopathy, Dilated dilated cardiomyopathy
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Congenital, Hereditary, and Neonatal Diseases and Abnormalitiesdisease of anatomical entity
Define:A form of CARDIAC MUSCLE disease that is characterized by ventricular dilation, VENTRICULAR DYSFUNCTION, and HEART FAILURE. Risk factors include SMOKING; ALCOHOL DRINKING; HYPERTENSION; INFECTION; PREGNANCY; and mutations in the LMNA gene encoding LAMIN TYPE A, a NUCLEAR LAMINA protein.An intrinsic cardiomyopathy that is characterized by an an enlarged heart and damage to the myocardium causing the heart to pump blood inefficiently.
Alias:Cardiomyopathy, Congestive//Cardiomyopathy, Dilated, 1a//Cardiomyopathy, Dilated, Autosomal Recessive//Cardiomyopathy, Dilated, CMD1A//Cardiomyopathy, Dilated, LMNA//Cardiomyopathy, Dilated, With Conduction Defect 1//Cardiomyopathy, Dilated, with Conduction Deffect1//Cardiomyopathy, Familial Idiopathic//Cardiomyopathy, Idiopathic Dilated//Congestive Cardiomyopathy//Dilated CardiomyopathyCongestive cardiomyopathy//Familial dilated cardiomyopathy//Idiopathic dilation cardiomyopathy//primary dilated cardiomyopathy



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)