Entry Detail



General Information

Database ID:TRD05936
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000070642DOID:0081292
Disease Name:Brain Injuries, Traumatictraumatic brain injury
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Wounds and Injuriesdisease of anatomical entity
Define:A form of acquired brain injury which occurs when a sudden trauma causes damage to the brain.A brain disease that is characterized by brain dysfunction caused by an outside force, usually a violent blow to the head.
Alias:Encephalopathy, Traumatic//Injury, Brain, Traumatic//TBI (Traumatic Brain Injury)//TBIs (Traumatic Brain Injuries)//Trauma, Brain//Traumatic Brain Injury//Traumatic EncephalopathyN/A



Disease Association Statistics

Total Associated tsRNA Number:54
More Information
Network:
(Display the first 15 nodes)