Entry Detail



General Information

Database ID:TRD05935
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001281DOID:0060224
Disease Name:Atrial Fibrillationatrial fibrillation
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:Abnormal cardiac rhythm that is characterized by rapid, uncoordinated firing of electrical impulses in the upper chambers of the heart (HEART ATRIA). In such case, blood cannot be effectively pumped into the lower chambers of the heart (HEART VENTRICLES). It is caused by abnormal impulse generation.A heart conduction disease that is characterized by uncoordinated electrical activity in the heart's upper chambers (the atria), which causes the heartbeat to become fast and irregular and has symptoms palpitations, weakness, fatigue, lightheadedness, dizziness, confusion, shortness of breath and chest pain.
Alias:Auricular Fibrillation//Familial Atrial Fibrillation//Paroxysmal Atrial Fibrillation//Persistent Atrial FibrillationA-fib//AFib



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)