Entry Detail



General Information

Database ID:TRD05867
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Lys-CTT-005
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:LysCTT
Sequence:GCCCAGCTAGCTCAGTCGGTAGAGCATGAGACTC
Related Target:N/A
Predicted Target:NFKBID//TNFRSF11A//EBI3//MGAT1//PES1//ALG14//JPH1//INTS6//KCNC4//TEX51
External Links:
MINTbase ID:tRF-17-8871K92
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003920DOID:9351
Disease Name:Diabetes Mellitusdiabetes mellitus
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Endocrine System Diseasesdisease of metabolism//genetic disease
Define:A heterogeneous group of disorders characterized by HYPERGLYCEMIA and GLUCOSE INTOLERANCE.A glucose metabolism disease that is characterized by chronic hyperglycaemia with disturbances of carbohydrate, fat and protein metabolism resulting from defects in insulin secretion, insulin action, or both.
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:47
More Information
Network:
(Display the first 15 nodes)