Entry Detail



General Information

Database ID:TRD05734
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.06 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Gly-GCC-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GlyGCC
Sequence:GCATAGGTGGTTCAGTGGTAGAATTCTTGCCTG
Related Target:N/A
Predicted Target:FCGR2A//LHX8//ZNF513//NDUFAF1//ZNF778//KCTD9//ERAS//SPRN//SORCS1//ARPP21
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D019636DOID:1289
Disease Name:Neurodegenerative Diseasesneurodegenerative disease
Category:MeSHDisease Ontology
Type:Nervous System Diseasesdisease of anatomical entity
Define:Hereditary and sporadic conditions which are characterized by progressive nervous system dysfunction. These disorders are often associated with atrophy of the affected central or peripheral nervous system structures.A central nervous system disease that results in the progressive deterioration of function or structure of neurons.
Alias:Degenerative Diseases, Central Nervous System//Degenerative Diseases, Nervous System//Degenerative Diseases, Neurologic//Degenerative Diseases, Spinal Cord//Degenerative Neurologic Diseases//Degenerative Neurologic Disorders//Nervous System Degenerative Diseases//Neurodegenerative Disorders//Neurologic Degenerative Conditions//Neurologic Degenerative Diseases//Neurologic Diseases, Degenerativedegenerative disease



Disease Association Statistics

Total Associated tsRNA Number:124
More Information
Network:
(Display the first 15 nodes)