Entry Detail


General Information

Database ID:TRD05524
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tsr007330
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:TAGGATAGGGTATTATTGGTAGCACGGAGAATTTTGAATT
Related Target:N/A
Predicted Target:FGFR1OP//ZSWIM3//HECW2//NUP155//PHLDA3//ATF7//PTPRD//TLN1//USH2A//FOCAD
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009203DOID:5844
Disease Name:Myocardial Infarctionmyocardial infarction
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:NECROSIS of the MYOCARDIUM caused by an obstruction of the blood supply to the heart (CORONARY CIRCULATION).A coronary artery disease characterized by myocardial cell death (myocardial necrosis) due to prolonged ischaemia.
Alias:Cardiovascular Stroke//Heart Attack//Myocardial Infarctheart attack//Myocardial infarct



Disease Association Statistics

Total Associated tsRNA Number:358
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:Western blot//RT-PCR
Weak Evidence:N/A



Reference

[1] PubMed ID:38810917
Disease Name:Myocardial Infarction
Tissue:rat myocardial tissue
Dysfunction Pattern:N/A
Validated Method:Western blot//RT-PCR
Description:As shown in Fig. 3E, the expression of rno-tsr004593 was significantly increased in myocardial infarction tissues, while the expression of rno-tsr007330 and rno-tsr001595 was down-regulated. This conclusion was also confirmed in vitro model experiments (Fig. 3F, I).
Comparision:Myocardial Infarction VS Normal
Mechanism:We found that overexpression of tsr007330 in rat myocardial tissue could antagonize NAT10, improve myocardial function in MI and alleviate myocardial fibrosis. In conclusion, tsRNAs (rno-tsr007330) may regulate the occurrence of myocardial fibrosis by regulating NAT10-mediated EGR3 mRNA acetylation.