tsRNADisease

Entry Detail

General Information

Database ID:	TRD05376
Confidence:	Very High
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics >> Evidence Support >> Reference

tsRNA Information

tsRNA Name:

tRF-27-ZDXPHO53KSN

tsRNA Type:

N/A

Amino acid and Anticodon:

N/A

Sequence:

TTGACTGCAGATCAAGAGGTCCCCGGT

Related Target:

Predicted Target:

External Links:

MINTbase ID:	tRF-27-ZDXPHO53KSN
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	1 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D001943	DOID:1612
Disease Name:	Breast Neoplasms	breast cancer
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Skin and Connective Tissue Diseases	disease of anatomical entity//disease of cellular proliferation
Define:	Tumors or cancer of the human BREAST.	A thoracic cancer that originates in the mammary gland.
Alias:	Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breast	breast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer

Disease Association Statistics

Total Associated tsRNA Number:	549 More Information
Network: (Display the first 15 nodes)

Evidence Support

Strong Evidence:	PCR//Western blot//EDU//Cell proliferation assay//Pull down assay
Weak Evidence:	Sequencing

Reference

[1] PubMed ID:	39113695
Disease Name:	Breast Neoplasms
Tissue:	Breast
Dysfunction Pattern:	Up-Regulation
Validated Method:	PCR//Western blot//EDU//Cell proliferation assay//Pull down assay//Sequencing
Description:	TRF-27-ZDXPHO53KSN was highly expressed in trastuzumab-resistant cells, and its expression level could predict the resistance to trastuzumab. High expression of tRF-27-ZDXPHO53KSN promoted the growth and proliferation of trastuzumab-exposed cells.
Comparision:	Cancer VS Normal
Mechanism:	RF-27-ZDXPHO53KSN can be used as a biomarker for predicting trastuzumab resistance in HER2-positive breast cancer. The expression of tRF-27 is associated with drug tolerance of HER2-positive breast cancer cells. TRF-27 binds to G3BPs in cells. G3BPs are key nucleation proteins for stress granules and regulate MTORC1 activation. Trastuzumab stimulation does not promote granule formation. In contrast, tRF-27 relies on a specific sequence to compete with LAMP1 in binding to the NTF2 domain of G3BPs.