Entry Detail


General Information

Database ID:TRD05369
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-23-Q99P9P9NDD
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:ACADSB
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D013274 DOID:10534
Disease Name:Stomach Neoplasmsstomach cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the STOMACH.A gastrointestinal system cancer that is located_in the stomach.
Alias:Cancer of Stomach//Cancer of the Stomach//Gastric Cancer//Gastric Cancer, Familial Diffuse//Gastric Neoplasms//Neoplasms, Gastric//Neoplasms, Stomach//Stomach Cancergastric cancer//gastric neoplasm



Disease Association Statistics

Total Associated tsRNA Number:79
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:PCR//Western blot//Transfection//Cell proliferation assay//Transwell assa
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:38725342
Disease Name:Stomach Neoplasms
Tissue:Stomach
Dysfunction Pattern:Up-Regulation
Validated Method:PCR//Western blot//Transfection//Cell proliferation assay//Transwell assa//High-throughput sequencing
Description:In this work, we confirmed for the first time that tRF-23-Q99P9P9NDD can promote the proliferation, migration, and invasion of GC cells in vitro.
Comparision:Cancer VS Normal
Mechanism:In this work, we confirmed for the first time that tRF-23-Q99P9P9NDD can promote the proliferation, migration, and invasion of GC cells in vitro. The dual luciferase reporter gene assay confirmed that tRF-23-Q99P9P9NDD could bind to the 3' untranslated region (UTR) site of acyl-coenzyme A dehydrogenase short/branched chain (ACADSB). In addition, ACADSB could rescue the effect of tRF-23-Q99P9P9NDD on GC cells.