Entry Detail



General Information

Database ID:TRD05368
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-22-8BWS72092
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:GGGTCAAATCTCGGTGGAAC
Related Target:METTL3
Predicted Target:PIP4K2A//NOL3//NLRP7//SRGAP3//ZC3H7A//GPR37L1//MAF//SMC1B//AP2A1//GET4
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000092342DOID:0111666
Disease Name:Polypoidal Choroidal Vasculopathyproliferative vasculopathy and hydranencephaly-hydrocephaly syndrome
Category:MeSHDisease Ontology
Type:Eye Diseases//Pathological Conditions, Signs and Symptomsgenetic disease//syndrome
Define:A CHOROID neovascularization characterized by serosanguineous retinal pigment epithelial detachment and leakage of serous exudate sometimes associated with aneurysmal polypoidal lesions.A syndrome characterized by hydranencephaly, glomeruloid vasculopathy of the central nervous system and retinal vessels, diffuse clastic ischemic lesions of the brain stem, basal ganglia, and spinal cord with calcifications, and fetal akinesia with arthrogryposis that has_material_basis_in homozygous or compound heterozygous mutation in the FLVCR2 gene on chromosome 14q24.3.
Alias:Idiopathic Polypoidal Choroidal Vasculopathy//Polypoidal CNV//Polypoidal Choroidal Neovascularizationcerebral proliferative glomeruloid vasculopathy//encephaloclastic proliferative vasculopathy//EPV//Fowler syndrome//Fowler vasculopathy//hydranencephaly, Fowler type//hydrocephaly/hydranencephaly due to cerebral vasculopathy//proliferative vasculopathy and hydranencephaly/hydrocephaly//PVHH



Disease Association Statistics

Total Associated tsRNA Number:1
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR//Western blot
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37355654
Disease Name:Polypoidal Choroidal Vasculopathy
Tissue:Vessel
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//Western blot//High-throughput sequencing
Description:The results revealed that tRF-22 expression was significantly down-regulated in myopic choroid. TRF-22 overexpression alleviated choroidal vasculopathy and retarded the progression of myopia in vivo. TRF-22 regulated choroidal endothelial cell viability, proliferation, migration, and tube formation ability in vitro.
Comparision:Disease VS Control
Mechanism:Mechanistically, tRF-22 interacted with METTL3 and blocked m6A methylation of Axin1 and Arid1b mRNA transcripts, which led to increased expression of Axin1 and Arid1b.