Entry Detail


General Information

Database ID:TRD05367
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-21-X3OJI8EWB
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:TGAGTGAAGCATTGGACTGTA
Related Target:N/A
Predicted Target:TUBGCP4//OR5P2//NFAT5//BCL2L11//TG//MRPS27//PDE1B//TKFC//PEX10//ANKRD26
External Links:
MINTbase ID:tRF-21-X3OJI8EWB
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:TyrGTA
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 5860        End Site(bp): 5880



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001943DOID:1612
Disease Name:Breast Neoplasmsbreast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the human BREAST.A thoracic cancer that originates in the mammary gland.
Alias:Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breastbreast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer



Disease Association Statistics

Total Associated tsRNA Number:549
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:Data Mining



Reference

[1] PubMed ID:40102335
Disease Name:Breast Neoplasms
Tissue:Breast
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//Data Mining
Description:Our analysis of 1,060 tumor samples from TCGA revealed that mt-tRF-Tyr-GTA-001 (tRF-21-X3OJI8EWB or t00018104) expression, a tRF from mitochondrial tRNA with tyrosine anticodon GTA (mt-tRNA-Tyr-GTA), was significantly lower in breast tumors than the adjacent tissues (p< 0.0001).
Comparision:Cancer VS Normal
Mechanism:In silico analysis showed that the binding targets of mt-tRF-Tyr-GTA-001 included several oncogenic transcription factors (E2Fs, CCNE1, FOXM1). We also found the mt-tRF correlated with the abundances of M0 macrophages and resting mast cells, two of the immune cells known for innate immunity.