Entry Detail



General Information

Database ID:TRD05366
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-21-U0EZY9X1B
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:TAAAGACTTTTTCTCTGACCA
Related Target:N/A
Predicted Target:RPL28//PHEX//TASOR2//RNFT1//PRMT2//FLG//TSC22D1//MPRIP//VCPIP1//PRKAG3
External Links:
MINTbase ID:tRF-21-U0EZY9X1B
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:ProTGG
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 15956-3        End Site(bp): 15973



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020181DOID:0050848
Disease Name:Sleep Apnea, Obstructiveobstructive sleep apnea
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Nervous System Diseasesdisease of mental health
Define:A disorder characterized by recurrent apneas during sleep despite persistent respiratory efforts. It is due to upper airway obstruction. The respiratory pauses may induce HYPERCAPNIA or HYPOXIA. Cardiac arrhythmias and elevation of systemic and pulmonary arterial pressures may occur. Frequent partial arousals occur throughout sleep, resulting in relative SLEEP DEPRIVATION and daytime tiredness. Associated conditions include OBESITY; ACROMEGALY; MYXEDEMA; micrognathia; MYOTONIC DYSTROPHY; adenotonsilar dystrophy; and NEUROMUSCULAR DISEASES. (From Adams et al., Principles of Neurology, 6th ed, p395)A sleep apnea that is characterized by repeated collapse and obstruction of the upper airway during sleep, which results in reduced airflow (hypopnea) or complete airflow cessation (apnea), oxygen desaturation, and arousals from sleep.
Alias:Apnea, Obstructive Sleep//OSAHS//Obstructive Sleep Apnea//Obstructive Sleep Apnea Syndrome//Sleep Apnea Hypopnea Syndrome//Sleep Apnea Syndrome, Obstructive//Syndrome, Obstructive Sleep Apnea//Syndrome, Sleep Apnea, Obstructive//Syndrome, Upper Airway Resistance, Sleep Apnea//Upper Airway Resistance Sleep Apnea Syndromeobstructive sleep apnea syndrome



Disease Association Statistics

Total Associated tsRNA Number:67
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:PCR//Western blot
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37101156
Disease Name:Sleep Apnea, Obstructive
Tissue:serum
Dysfunction Pattern:Down-Regulation
Validated Method:PCR//Western blot//High-throughput sequencing
Description:The plasma expression levels of tRF-21-U0EZY9X1B (tRF-21) were significantly different between the two groups. Receiver operating characteristic curve (ROC) showed that it had valuable diagnostic index, with area under the curve (AUC) of 0.773, 86.71% And 63.16% Sensitivity and specificity.
Comparision:Disease VS Control
Mechanism:The results of correlation analysis showed that the expression level of tRF-21 was linearly correlated with the degree of tonsillar enlargement. It suggests that the level of tRF-21 may be related to the severity of OSAHS. However, there is no significant correlation between the tRF and the OAHI index. In addition, the tRF-21 level is significantly correlated with Hb, MCH, TG and CK-MB, which could be predicted by MCH, TG and CK-MB.