Entry Detail


General Information

Database ID:TRD05365
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-M0NK5Y93
tsRNA Type:N/A
Amino acid and Anticodon:N/A
Sequence:CGGAGCTGGGGATTGTGGGT
Related Target:PLOD1
Predicted Target:CDCP2//AL357673.1//MUC5B//TMEM150C//MUC12//C1orf159//SLC39A13//MAOA//MROH1//RILP
External Links:
MINTbase ID:tRF-20-M0NK5Y93
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-CCG-2-1
Anticodon:ArgCCG
tRNA_number:trna23
Chromosome:17
Strand:-
Coordinate:Start Site(bp): 66016032        End Site(bp): 66016051



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002289DOID:3908
Disease Name:Carcinoma, Non-Small-Cell Lunglung non-small cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Respiratory Tract Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy.A lung carcinoma that is characterized as any type of epithelial lung cancer other than small cell lung carcinoma.
Alias:Carcinoma, Non-Small Cell Lung//Non-Small Cell Lung Cancer//Non-Small Cell Lung Carcinoma//Non-Small-Cell Lung Carcinoma//Nonsmall Cell Lung CancerNon-small cell lung cancer//non-small cell lung carcinoma//NSCLC



Disease Association Statistics

Total Associated tsRNA Number:132
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR//Western blot//Transfection//Luciferase reporter assay//Cell proliferation assay//Transwell assay
Weak Evidence:Sequencing



Reference

[1] PubMed ID:40262693
Disease Name:Carcinoma, Non-Small-Cell Lung
Tissue:Lung
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//Western blot//Transfection//Luciferase reporter assay//Cell proliferation assay//Transwell assay//Sequencing
Description:The RNA-sequencing assay revealed a significant decrease in the expression of tRF-20-M0NK5Y93 in tumor tissues. In line with this finding, qRT-PCR analysis further confirmed a meaningful downregulation of tRF-20-M0NK5Y93 in 46 patient samples with NSCLC.
Comparision:Cancer VS Normal
Mechanism:tRF-20-M0NK5Y93 was capable of binding to PLOD1, thereby negatively regulating its expression. Notably, the restoration of PLOD1 expression was able to counteract the inhibitory effects of enforced tRF-20-M0NK5Y93 on NSCLC cell proliferation, migration, and apoptosis.