Entry Detail



General Information

Database ID:TRD05204
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-Val-CAC-2
tsRNA Type:N/A
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATCACGTTCGCCTC
Related Target:N/A
Predicted Target:ZBED2//ERAP1//PTPN14//OBSCN//NPTXR//CLASRP//NR1H3//AGRN//HK2//CDC25C
External Links:
MINTbase ID:tRF-34-Q99P9P9NH57S15
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248088        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010190DOID:1793
Disease Name:Pancreatic Neoplasmspancreatic cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).An endocrine gland cancer located_in the pancreas.
Alias:Cancer of Pancreas//Cancer of the Pancreas//Neoplasms, Pancreatic//Pancreas Cancer//Pancreas Neoplasms//Pancreatic CancerCa body of pancreas//Ca head of pancreas//Ca tail of pancreas//malignant neoplasm of body of pancreas//malignant neoplasm of head of pancreas//malignant neoplasm of tail of pancreas pancreas neoplasm [EXACT] pancreatic neoplasm [EXACT] pancreatic tumor [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:112
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:Western blot
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:38443680
Disease Name:Pancreatic Neoplasms
Tissue:pancreas
Dysfunction Pattern:Up-Regulation
Validated Method:Western blot//High-throughput sequencing
Description:Here, we screened and identified tiRNA-Val-CAC-2 as highly expressed in pancreatic cancer metastasis samples by tsRNA sequencing.
Comparision:Metastatic Pancreatic Cancer VS Primary
Mechanism:tiRNA-Val-CAC-2 interacts with FUBP1 to promote pancreatic cancer metastasis by activating c‑MYC transcription