Entry Detail


General Information

Database ID:TRD04990
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-1:33-Pro-TGG-1
tsRNA Type:N/A
Amino acid and Anticodon:ProTGG
Sequence:GGCTCGTGGTCTAGTGGTATGATTCTCGCTTT
Related Target:N/A
Predicted Target:BMP8A//BMP8B//DPF1//SLC3A1//GPR82//ACSS1//STAB2//ZNF407//GHR//ZNF777
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D015179DOID:9256
Disease Name:Colorectal Neoplasmscolorectal cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.A large intestine cancer that is located_in the colon and/or located_in the rectum.
Alias:Colorectal Cancer//Colorectal Carcinoma//Colorectal Tumors//Neoplasms, ColorectalN/A



Disease Association Statistics

Total Associated tsRNA Number:195
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37389118
Disease Name:Colorectal Neoplasms
Tissue:N/A
Dysfunction Pattern:Up-Regulation
Validated Method:PCR//High-throughput sequencing
Description:The size of all collected lesions ranged from 4 to 15 mm, with an average of 6.31 ± 3.07 mm. tiRNA-1:33-Gly-CCC-2, tiRNA-1:33-Pro-TGG-1, and tiRNA-1:34-Thr-TGT-4-M2 were significantly upregulated in SSLs compared to those in the paired NC (P = 0.0059, 0.0309, and 0.0008, respectively).
Comparision:SSL VS Normal
Mechanism:5′tiRNA-Pro-TGG potentially promotes the progression of serrated pathway CRC through metabolic and immune pathways by interacting with HPSE2 and regulating its expression in SSLs and BRAF-mutant CRC. In the future, it may be possible to use tiRNAs as novel biomarkers for early diagnosis of SSLs and as potential therapeutic targets in serrated pathway of CRC.