Entry Detail


General Information

Database ID:TRD04982
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Pro-CGG
tsRNA Type:N/A
Amino acid and Anticodon:ProCGG
Sequence:GAAGCGAGAATCATACCCCTAGACCAACGAGCC
Related Target:N/A
Predicted Target:SRCAP//ANKRD52//TMEM200B//RCOR1//LRPAP1//SHC3//HECTD3//TRIM5//ZYG11A//KRT15
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D021441DOID:3498
Disease Name:Carcinoma, Pancreatic Ductalpancreatic ductal adenocarcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS.A pancreatic adenocarcinoma that derives_from pancreatic duct cells.
Alias:Carcinoma, Ductal, Pancreatic//Duct-Cell Carcinoma of the Pancreas//Duct-Cell Carcinoma, Pancreas//Ductal Carcinoma of the Pancreas//Pancreatic Duct Cell Carcinoma//Pancreatic Ductal Carcinomaductal adenocarcinoma of the pancreas



Disease Association Statistics

Total Associated tsRNA Number:114
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR//FISH
Weak Evidence:N/A



Reference

[1] PubMed ID:33675071
Disease Name:Carcinoma, Pancreatic Ductal
Tissue:Human Pancreatic Ductal Adenocarcinoma Tissue
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//FISH
Description:N/A
Comparision:Cancer VS Normal
Mechanism:N/A