Entry Detail


General Information

Database ID:TRD04640
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRFs1
tsRNA Type:N/A
Amino acid and Anticodon:GlyGCC
Sequence:GCAATGGTGGTTCAGTGGTAGAATTCTCGC
Related Target:N/A
Predicted Target:FCGR2A//PTCD3//C9orf129//OLFM3//C8orf82//PEG10//KPNA6//ZG16B//PLA2R1//LIMCH1
External Links:
MINTbase ID:tRF-30-PER8YP9LON4V
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Glu-TTC-9-1
Anticodon:GluTTC
tRNA_number:trna17
Chromosome:2
Strand:-
Coordinate:Start Site(bp): 204229172        End Site(bp): 204229201



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002312DOID:11984
Disease Name:Cardiomyopathy, Hypertrophichypertrophic cardiomyopathy
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:A form of CARDIAC MUSCLE disease, characterized by left and/or right ventricular hypertrophy (HYPERTROPHY, LEFT VENTRICULAR; HYPERTROPHY, RIGHT VENTRICULAR), frequent asymmetrical involvement of the HEART SEPTUM, and normal or reduced left ventricular volume. Risk factors include HYPERTENSION; AORTIC STENOSIS; and gene MUTATION; (FAMILIAL HYPERTROPHIC CARDIOMYOPATHY).An intrinsic cardiomyopathy that is characterized by abnormal thickening (hypertrophy) of the heart without any obvious cause.
Alias:Cardiomyopathy, Hypertrophic Obstructivehypertrophic obstructive cardiomyopathy



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:30012983
Disease Name:Cardiomyopathy, Hypertrophic
Tissue:Heart
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:As shown in Figure 2D, the expression levels of hypertrophic markers such as ANF, BNP, and β-MHC were all elevated in tRFs1 and tRFs2 over-expression cells, but there was no effect on cells treated with tRFs10 mimics.
Comparision:Hyp VS Control
Mechanism:Compared to Con F1 offspring, Hyp F1 offspring had elevated expression levels of β-MHC and ANP genes, and they had increased fibrosis and apoptosis in their hearts. These results demonstrated that tRFs are involved in regulating the response of myocardial hypertrophy. Besides, tRFs might serve as novel epigenetic factors that contribute to the intergenerational inheritance of cardiac hypertrophy.