Entry Detail



General Information

Database ID:TRD04441
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-5030-GlnTTG-3
tsRNA Type:N/A
Amino acid and Anticodon:GlnTTG
Sequence:GGTCCCGTGGTGTAATGGTTAGCACTCTGG
Related Target:N/A
Predicted Target:NEFL//PDGFRB//PRRC2B//C19orf85//CFAP77//TEC//ZNF691//CXXC1//GNAS//HAGH
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D004715DOID:289
Disease Name:Endometriosisendometriosis
Category:MeSHDisease Ontology
Type:Urogenital Diseasesdisease of anatomical entity
Define:A condition in which functional endometrial tissue is present outside the UTERUS. It is often confined to the PELVIS involving the OVARY, the ligaments, cul-de-sac, and the uterovesical peritoneum. A female reproductive system disease characterized by the growth of endometrial tissue outside the uterine body.
Alias:EndometriomaN/A



Disease Association Statistics

Total Associated tsRNA Number:12
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:35281615
Disease Name:Endometriosis
Tissue:Uterus
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:The differential expression of tRF/tiRNA in endometriosis may be related to the pathogenesis of endometriosis. Furthermore, tRF/tiRNA may be a biomarker for the diagnosis and treatment of EMs in the future.
Comparision:Disease VS Control
Mechanism:Gene Ontology and pathway analysis showed that the target genes of TRF396 and tiRNA-5030-GlnTTG-3 were mainly involved in the intrinsic components of the membrane and the overall composition of the membrane in cell components; Molecular functions mainly involve olfactory conduction and G protein-coupled receptor activity. In the biological process, it was mainly involved in the detection of sensory stimuli. The target genes of TRF308 and TRF320 were mainly involved in the intracellular part; Molecular functions are mainly related to DNA binding transcription factor activity and protein binding and mainly related to biological regulation of biological processes. Pathway analysis showed that the RAP1 signaling pathway and the AXON GUIDANCE signaling pathway may participate in the progression of endometriosis.