Entry Detail


General Information

Database ID:TRD04355
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-1:32-chrM.Cys-GCA
tsRNA Type:N/A
Amino acid and Anticodon:CysGCA
Sequence:CTCCGAGGTGATTTTCATATTGA
Related Target:N/A
Predicted Target:RYR3//SMAD3//ACACA//ICAM3//SQSTM1//MUC16//CDK19//INSIG1//WNT3//ATP5MF
External Links:
MINTbase ID:tRF-23-4S14IZJQ0L
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:CysGCA
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 5802        End Site(bp): 5824



tsRNA Association Statistics

Total Associated Disease Number:6
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000784DOID:0080685
Disease Name:Aortic dissectionaortic dissection
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:A tear in the inner layer of the AORTA leading to interstitial HEMORRHAGE, and splitting (dissecting) of the aortic TUNICA MEDIA layer. It typically begins with a tear in the TUNICA INTIMA layer.An aortic disease that is characterized by tearing of the intimal layer of the aorta resulting in separation of the layers of the aortic wall.
Alias:Aneurysm, Dissecting//Aortic Dissecting Aneurysm//Dissecting Aneurysm//Dissecting Aneurysm AortaN/A



Disease Association Statistics

Total Associated tsRNA Number:23
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:34214628
Disease Name:Aortic dissection
Tissue:Aorta
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:Results revealed that a total of 41 tRFs/tiRNAs were dysregulated in the AD group compared to the control group. Among them, 12 were upregulated and 29 were downregulated (fold change≥1.5 And p < 0.05). RT-qPCR results revealed that expressions of tRF-1:30-chrM.Met-CAT was significantly upregulated, while that of tRF-54:71-chrM.Trp-TCA and tRF-1:32-chrM.Cys-GCA were notably downregulated; Expression patterns were consistent with the RNA sequencing data. Bioinformatic analysis showed that a variety of related pathways might be involved in the pathogenesis of AD. Functionally, tRF-1:32-chrM.Met-CAT could facilitate proliferation, migration, and phenotype switching in vascular smooth muscle cells (VSMCs), which might serve as a significant regulator in the progression of AD.
Comparision:Disease VS Control
Mechanism:N/A