Entry Detail


General Information

Database ID:TRD04346
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRNA-Cys-5-0007
tsRNA Type:N/A
Amino acid and Anticodon:CysACA
Sequence:TACCCCTGAGCTATACCCCC
Related Target:VEGFA//TGF-β3
Predicted Target:UQCR10//SYNGAP1//CRB1//CMIP//ZNF277//NRXN3//PHC3//MCEMP1//MAN2A2//LONP2
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D016491DOID:341
Disease Name:Peripheral Vascular Diseasesperipheral vascular disease
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:Pathological processes involving any one of the BLOOD VESSELS in the vasculature outside the HEART.A vascular disease that is characterized by obstruction of larger arteries not within the coronary, aortic arch vasculature, or brain.
Alias:Diseases, Peripheral Vascular//Peripheral Angiopathies//Vascular Diseases, Peripheralarterial occlusive disease



Disease Association Statistics

Total Associated tsRNA Number:1
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR//Western blot
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:38867291
Disease Name:Peripheral Vascular Diseases
Tissue:Vessel
Dysfunction Pattern:N/A
Validated Method:RT-PCR//Western blot//High-throughput sequencing
Description:TRNA-Cys-5-0007 expression was down-regulated under angiogenic conditions. Conversely, tRNA-Cys-5-0007 overexpression exhibited anti-angiogenic effects in retinal endothelial cells, as evidenced by reduced proliferation, sprouting, migration, and tube formation abilities. In diabetic, laser-induced CNV, and OIR models, tRNA-Cys-5-0007 overexpression led to decreased ocular vessel leakage, inhibited angiogenesis, and reduced ocular inflammation.
Comparision:Disease VS Control
Mechanism:Mechanistically, these effects were attributed to the targeting of vascular endothelial growth factor A (VEGFA) and TGF-β1 by tRNA-Cys-5-0007. The utilization of an exosomal formulation further potentiated the synergistic anti-angiogenic and anti-inflammatory efficacy of tRNA-Cys-5-0007.