Entry Detail


General Information

Database ID:TRD04228
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tsRNA-Arg-CCG
tsRNA Type:N/A
Amino acid and Anticodon:ArgCCG
Sequence:GACCCAGTGGCCTAATGGATAAGGCATCAGCCTCCG
Related Target:N/A
Predicted Target:NAT10//CIZ1//BAK1//SIK1//SIK1B//TKT//TNFRSF21//ILF3//CNTN4//SLC16A2
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D050197 DOID:1936
Disease Name:Atherosclerosisatherosclerosis
Category:MeSHDisease Ontology
Type:Cardiovascular Diseasesdisease of anatomical entity
Define:A thickening and loss of elasticity of the walls of ARTERIES that occurs with formation of ATHEROSCLEROTIC PLAQUES within the ARTERIAL INTIMA.N/A
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:271
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing//High-throughput sequencing



Reference

[1] PubMed ID:36871792
Disease Name:Atherosclerosis
Tissue:Arterial Tissues
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing//High-throughput sequencing
Description:HCD-induced tsRNA-Arg-CCG affects proatherogenic gene expression in endothelial cells in vitro.
Comparision:HCD VS LCD
Mechanism:Interestingly, we found that overexpression of synthetic tsRNA-Arg-CCG led to increased expression of several proatherogenic genes, including IL-6, IL-1α, ICAM-1, VCAM-1, and MCP-1 in HMEC-1 cells (Fig. 6C). Therefore, tsRNA-Arg-CCG may have proatherogenic properties in vivo, which warrants further investigation.