Entry Detail



General Information

Database ID:TRD04058
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-31-Q99P9P9NH57SD
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATCACGTTCGC
Related Target:N/A
Predicted Target:SREBF2//PTPN14//CLASRP//CASZ1//G6PC3//ERAP1//YAF2//SFT2D3//PELP1//HSPA6
External Links:
MINTbase ID:tRF-31-Q99P9P9NH57SD
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248091        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077192DOID:3910
Disease Name:Adenocarcinoma of Lunglung adenocarcinoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of anatomical entity//disease of cellular proliferation
Define:A carcinoma originating in the lung and the most common lung cancer type in never-smokers. Malignant cells exhibit distinct features such as glandular epithelial, or tubular morphology. Mutations in KRAS, EGFR, BRAF, and ERBB2 genes are associated with this cancer.A lung non-small cell carcinoma that derives_from epithelial cells of glandular origin.
Alias:Lung Adenocarcinomaadenocarcinoma of lung//bronchogenic lung adenocarcinoma//nonsmall cell adenocarcinoma



Disease Association Statistics

Total Associated tsRNA Number:203
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:35115004
Disease Name:Adenocarcinoma of Lung
Tissue:Lung glands
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:Only 155 consistent differential expression tsRNA (Co-DEtsRNAs) were detected by intersection analysis, 135 of which were up-regulated and 20 of which were down-regulated, and these were kept for further analysis.
Comparision:LUAD VS Normal
Mechanism:N/A