Entry Detail


General Information

Database ID:TRD03922
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF5–22-SerGCT-1
tsRNA Type:tRF-5
Amino acid and Anticodon:SerGCT
Sequence:TTAACCACTCGGCCACCTCGTC
Related Target:MSK1
Predicted Target:RASL10B//NRDE2//CERCAM//ZNF559-ZNF177//ZNF559//RGL3//DRC7//HMGXB3//NFAM1//HNRNPK
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D056989DOID:5844
Disease Name:Acute Inferior Myocardial Infarctionmyocardial infarction
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:MYOCARDIAL INFARCTION in which the inferior wall of the heart is involved. It is often caused by occlusion of the right coronary artery.A coronary artery disease characterized by myocardial cell death (myocardial necrosis) due to prolonged ischaemia.
Alias:Acute Inferior Myocardial Infarction//Diaphragmatic Myocardial Infarction//Inferior Myocardial Infarction//Myocardial Infarction, Inferior Wallheart attack//Myocardial infarct



Disease Association Statistics

Total Associated tsRNA Number:1
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:40269521
Disease Name:Acute Inferior Myocardial Infarction
Tissue:Heart
Dysfunction Pattern:N/A
Validated Method:RT-PCR//High-throughput sequencing
Description:Ncreasing evidence have demonstrated that tsRNAs were involved in the pathological process of various disorders [
Comparision:Disease VS Control
Mechanism:In the present study, we also validated tRF5–22-SerGCT-1 in hypoxic and normoxic cardiomyocytes, which were consistent with the data of sequencing. We proved that downregulation of tRF5–22-SerGCT-1 in cardiomyocytes significantly decreased cell viability and increased apoptosis. We also found that overexpression of tRF5–22-SerGCT-1 cardiomyocytes increased the expression of MSK1 protein which were closely related to myocardial injury and apoptosis.