tsRNADisease

Entry Detail

General Information

Database ID:	TRD03894
Confidence:	High
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics >> Evidence Support >> Reference

tsRNA Information

tsRNA Name:

tRF-1:22-chrM.Ser-GCT

tsRNA Type:

tRF-5

Amino acid and Anticodon:

SerGCT

Sequence:

GAGAAAGCTCACAAGAACTGCT

Related Target:

Predicted Target:

PTPRZ1//C4orf33//GTPBP10//SLC24A4//SCGN//ZNF540//TBC1D19//DTX4//SYNPO2//ARIH1

External Links:

MINTbase ID:	tRF-22-5BF900BY3
tRFdb ID:	N/A

[1] gtRNAdb_ID:	-
Anticodon:	SerGCT
tRNA_number:	trnaMT
Chromosome:	MT
Strand:	+
Coordinate:	Start Site(bp): 12207 End Site(bp): 12228

tsRNA Association Statistics

Total Associated Disease Number:	14 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D003930	DOID:13207
Disease Name:	Diabetic Retinopathy	proliferative diabetic retinopathy
Category:	MeSH	Disease Ontology
Type:	Eye Diseases//Cardiovascular Diseases//Endocrine System Diseases	disease of anatomical entity//nervous system disease
Define:	Disease of the RETINA as a complication of DIABETES MELLITUS. It is characterized by the progressive microvascular complications, such as ANEURYSM, interretinal EDEMA, and intraocular PATHOLOGIC NEOVASCULARIZATION.	N/A
Alias:	N/A	PDR

Disease Association Statistics

Total Associated tsRNA Number:	86 More Information
Network: (Display the first 15 nodes)

Evidence Support

Strong Evidence:	RT-PCR
Weak Evidence:	High-throughput sequencing

Reference

[1] PubMed ID:	35903272
Disease Name:	Diabetic Retinopathy
Tissue:	Vitreous humor samples
Dysfunction Pattern:	Up-Regulation
Validated Method:	RT-PCR//High-throughput sequencing
Description:	The top 10 up- and down-regulated tsRNAs are listed in Table 4.
Comparision:	PDR VS Normal
Mechanism:	In this study, we identified the AMPK signaling pathway as a leading enriched pathway associated with the altered tsRNAs (Figure 4B), which also suggested that these tsRNAs might have regulatory functions in the pathogenesis of DR.