Entry Detail



General Information

Database ID:TRD03609
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-25-0P58309NDJ
tsRNA Type:tRF-5
Amino acid and Anticodon:LeuTAA
Sequence:ACCAGGATGGCCGAGTGGTTAAGGC
Related Target:N/A
Predicted Target:RGMA//ZBTB7A//GSTT2B//GSTT2//TENM4//PHYHIP//CTBP2//SLC6A3//RFX3//ZNF213
External Links:
MINTbase ID:tRF-25-0P58309NDJ
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Leu-TAA-1-1
Anticodon:LeuTAA
tRNA_number:trna83
Chromosome:6
Strand:+
Coordinate:Start Site(bp): 144537684        End Site(bp): 144537708



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D016889DOID:0050939
Disease Name:Endometrial Neoplasmsuterine corpus endometrial carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of cellular proliferation//disease of anatomical entity
Define:Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells.A uterine corpus cancer that is derives_from the inner lining of the uterus.
Alias:Cancer of Endometrium//Cancer of the Endometrium//Carcinoma of Endometrium//Endometrial Cancer//Endometrial Carcinoma//Endometrium Cancer//Neoplasms, EndometrialN/A



Disease Association Statistics

Total Associated tsRNA Number:227
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:36803014
Disease Name:Endometrial Neoplasms
Tissue:Endometrium
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:The levels of tsRNAs between EC tissues and normal endometrial tissues were compared and 173 differentially expressed tsRNAs were identified, including 80 downregulated and 93 upregulated tsRNAs (Figure 1B & C). All differentially expressed tsRNAs are listed in Supplementary Table 2.
Comparision:Cancer VS Normal
Mechanism:N/A