Entry Detail



General Information

Database ID:TRD03462
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:5P_tRNA-His-GTG-1-9
tsRNA Type:tRF-5
Amino acid and Anticodon:HisGTG
Sequence:TCGTGGCGTCCCGGTAGCTC
Related Target:N/A
Predicted Target:SHF//P3H3//CLDN23//SLC9A7//ASTN2//NKX6-2//ADGRB1//SPC24//USP6NL//RBBP8NL
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002289DOID:3908
Disease Name:Carcinoma, Non-Small-Cell Lunglung non-small cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Respiratory Tract Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy.A lung carcinoma that is characterized as any type of epithelial lung cancer other than small cell lung carcinoma.
Alias:Carcinoma, Non-Small Cell Lung//Non-Small Cell Lung Cancer//Non-Small Cell Lung Carcinoma//Non-Small-Cell Lung Carcinoma//Nonsmall Cell Lung CancerNon-small cell lung cancer//non-small cell lung carcinoma//NSCLC



Disease Association Statistics

Total Associated tsRNA Number:132
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35892120
Disease Name:Carcinoma, Non-Small-Cell Lung
Tissue:Lung
Dysfunction Pattern:Down-Regulation
Validated Method:Data Mining
Description:Due to the different data platforms, GEO and TCGA were separately calculated. We used Deseq2 and t test in two GEO datasets (GEO: GSE83527 and GEO: GSE62812) and TCGA-LUAD cohort based on both raw read counts and normalized expression profile transcripts per million mapped reads (TPM), respectively.
Comparision:Cancer VS Normal
Mechanism:N/A